UCSF

Common Primer Sequences

Chen Lab common primers for sequencing

  • pENTR-F: CTACAAACTCTTCCTGTTAGTTA
  • pENTR-R: GTAACATCAGAGATTTTGAGACAC
  • pT3EF-5a-F: TACCGAGCTCGGATCCACTAGT
  • pT3EF-5a-R: AATGACACCTACTCAGAC
  • pT3EF-1aH-F: GAGTTTGGATCTTGGTTCATTC
  • pT3EF-1aH-R: TAGAAGGCACAGTCGAGG
  • pLENTI-CMV-F: CGCAAATGGGCGGTAGGCGTG
  • pLKO-F: AAACCCAGGGCTGCCTTGGAAAAG
  • U6seqF: ACTATCATATGCTTACCGTAAC